Categories
Data Science SQL

SQLite3 For Data Science and Metadata Management

Date Field There is no DATE type in SQLite, so in order to effectively sort and filter dates we can use a TEXT field that uses the ISO 8601 standard date format: yyyy-mm-dd. To ensure that all dates inserted into this field are properly formatted, we can apply a CHECK constraint. In this case, we […]

Categories
Bioinformatics C

FastA

In computational biology, the fasta file format is used to represent both deoxyribonucleic acid (DNA) and amino acid (AA) sequences. Each contiguous sequence (contig) in a fasta begins with a >header line followed by one or more lines of character strings. In the case of DNA, the nucleotides of the sequence are represented by the […]

Categories
Bioinformatics C++

kmers

DNA In computational biology, we often analyze the DNA of organisms. DNA is made up of a string of molecules called nucleotides, which are represented by the characters A, T, C, and G. ATCGCGATATCGCGATATCGCGATATCGCGAT Compliment Although we represent DNA using only one sequence of characters, it is actually stored as two connected strands called a […]

Categories
Embedded Linux

Setting up my STM32 Microcontroller Development Environment

The STM32 is a 32-bit microcontroller used in embedded systems. In this post, I will show how I setup an environment for writing code and flashing it to a STM32 "blue pill" board. INTRODUCTION This post needs an introduction describing the purpose of the post. METHODS Install Dependencies $ pacman -S arm-none-eabi-gcc newlib stlink openocd […]

Categories
Linux

Configuring Arch for Software Development

A software developer spends countless hours starting at a computer screen and should look forward to booting up their development environment. This means that recurring tasks such as changing screens should only be a keystroke away, and the fonts and colors are easy on the eyes. In this post I will go over how I […]

Categories
Linux

Installing Arch Linux for Software Development

I successfully installed Arch Linux on an old ASUS laptop. I chose the Arch distribution because "the default installation is a minimal base system, configured by the user to only add what is purposely required." This allowed me to limit the number of services running and maximize the storage space available by only installing services […]

Categories
Uncategorized

hello, world

Hello, world! My name is Sean Beagle, and I’m happy that you’ve found this website. You will find a series of discussions and tutorials related to software development, bioinformatics, and embedded systems. I hope that you find them interesting and helpful, and keep coming back for more!